Most active commenters

    ←back to thread

    Baby is healed with first personalized gene-editing treatment

    (www.nytimes.com)
    1163 points jbredeche | 21 comments | 15 May 25 18:06 UTC | HN request time: 0.996s | source | bottom
    Show context
    MrZander ◴[15 May 25 19:30 UTC] No.43998447[source]▶
    > To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.

    That is one of the most incredible things I have ever read.

    replies(20): >>43998602 #>>43999018 #>>43999182 #>>43999228 #>>43999351 #>>43999647 #>>43999883 #>>44000363 #>>44000383 #>>44000524 #>>44000545 #>>44000725 #>>44001330 #>>44002188 #>>44002243 #>>44002289 #>>44002568 #>>44003457 #>>44008340 #>>44011060 #
    1. poyu ◴[15 May 25 19:46 UTC] No.43998602[source]▶
    Made it sound like it's a computer, is it Turing complete?
    replies(9): >>43998643 #>>43998749 #>>43998847 #>>43998855 #>>43998871 #>>43998952 #>>43998991 #>>43999148 #>>44000096 #
    2. lordnacho ◴[15 May 25 19:51 UTC] No.43998643[source]▶
    Wouldn't it be surprising if it weren't? There's a bunch of things that are Turing complete, but they are not literally a molecular tape with machinery to read and write it.
    3. caycep ◴[15 May 25 20:02 UTC] No.43998749[source]▶
    I think I recall reading at least some papers or at least exercises trying to draw analogies between Turing machines and ribosome/proteonsome and other type of cellular proteins, but I can't remember back to that class some 20 years ago...
    4. fwip ◴[15 May 25 20:13 UTC] No.43998847[source]▶
    Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
    replies(2): >>44000195 #>>44002182 #
    5. koeng ◴[15 May 25 20:14 UTC] No.43998855[source]▶
    It's fundamentally different than a computer and arguably more complete.

    The talk of "crawling along the genome" is kinda fundamentally wrong though and is a bit irking - CRISPR kinda just bumps around until it hits a PAM site, in which case it starts checking against sgRNA. Much more random than they make it seem

    replies(2): >>44000187 #>>44006577 #
    6. Robotbeat ◴[15 May 25 20:16 UTC] No.43998871[source]▶
    Yeah, in some ways, the genetic code and molecular biology around transcription, etc, more closely resembles the abstract Turing Machine than an actual computer does. Absolutely fascinating that the messy world of biology ends up being pretty analogous to the clean world of binary logic. Gene sizes are expressed in kilobases, where a base carries 2 bits of information.
    7. davedx ◴[15 May 25 20:24 UTC] No.43998952[source]▶
    Sounds kind of like the infinite tape machine....
    replies(1): >>44005678 #
    8. buzzy_hacker ◴[15 May 25 20:28 UTC] No.43998991[source]▶
    Made me think of

        It was only in college, when I read Douglas Hofstadter’s Gödel, Escher, Bach, that I came to understand cells as recursively self-modifying programs. The language alone was evocative. It suggested that the embryo—DNA making RNA, RNA making protein, protein regulating the transcription of DNA into RNA—was like a small Lisp program, with macros begetting macros begetting macros, the source code containing within it all of the instructions required for life on Earth. Could anything more interesting be imagined?

    Someone should have said this to me:

    > Imagine a flashy spaceship lands in your backyard. The door opens and you are invited to investigate everything to see what you can learn. The technology is clearly millions of years beyond what we can make.
    >
    > This is biology.
   
    –Bert Hubert, “Our Amazing Immune System”
    from https://jsomers.net/i-should-have-loved-biology/
    replies(1): >>43999620 #
    9. dekhn ◴[15 May 25 20:43 UTC] No.43999148[source]▶
    This system isn't really turing complete, but existing biology provides everything required to make a computer which is Turing complete (assuming non-infinite tape size).

    True programmatic biology is still very underdeveloped. I have seen logic gates, memory, and state machines all implemented, but I don't think anybody has built somethign with a straightforward instruction set, program counter, addressable RAM, and registers that was useful enough to justify advanced research.

    10. duskwuff ◴[15 May 25 21:43 UTC] No.43999620[source]▶
    >> Imagine a flashy spaceship

    I misread this as "fleshy" for a moment, and the quote almost works better that way.

    replies(1): >>44011631 #
    11. joshmarlow ◴[15 May 25 22:42 UTC] No.44000096[source]▶
    If this thread interests you, you should check out "Blood Music" by Greg Bear. It's pretty old but the premise is that a researcher 'closes the loop' in a bunch of cells by making them able to edit their own DNA - thus making them Turing Complete.

    Hilarity subsequently ensues.

    replies(2): >>44000194 #>>44002204 #
    12. anthk ◴[15 May 25 22:57 UTC] No.44000187[source]▶
    This is crazier: https://www.sciencealert.com/are-we-all-quantum-computers-wi...

    About CRISP, it's like the ultimate Perl+Regex for the body.

    replies(1): >>44003835 #
    13. dekhn ◴[15 May 25 22:58 UTC] No.44000194[source]▶
    Cells are already able to edit their own DNA. Examples include the yeast mating switch, in which the "active" gene is replaced by one of two templates, determining the role the yeast plays in mating (https://en.wikipedia.org/wiki/Mating_of_yeast#Mechanics_of_t...)

    Further, your immune system does some clever combinatorial swapping to achieve diversity (https://en.wikipedia.org/wiki/V(D)J_recombination). The generated diversity is then screened by the immune system to find highly effective antibodies that bind to specific foreign invaders.

    Doing something actually interesting from an engineering perspective makes for fun science fiction, but as always, the specific details in that story would be a very unlikely outcome.

    14. anthk ◴[15 May 25 22:58 UTC] No.44000195[source]▶
    So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.
    15. xarope ◴[16 May 25 05:48 UTC] No.44002182[source]▶
    TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

    (core war, anybody?)

    replies(1): >>44012206 #
    16. xarope ◴[16 May 25 05:52 UTC] No.44002204[source]▶
    As I get older, I'd be happy with some minor incremental progress on addressing myopia and hyperopia.
    17. dagurp ◴[16 May 25 10:53 UTC] No.44003835{3}[source]▶
    sounds more like sed
    18. mr_toad ◴[16 May 25 14:04 UTC] No.44005678[source]▶
    About 6 billion letters in human DNA.
    19. drjasonharrison ◴[16 May 25 15:22 UTC] No.44006577[source]▶
    "Bumps around until it hits" sounds like a set of magnets arranged to only mate up in a specific direction. Except we have four nucleotides rather than only two magnetic poles.
    20. floam ◴[17 May 25 02:39 UTC] No.44011631{3}[source]▶
    Me too. It did. Huh.
    21. duskwuff ◴[17 May 25 05:16 UTC] No.44012206{3}[source]▶
    I don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/