←back to thread

Baby is healed with first personalized gene-editing treatment

(www.nytimes.com)
1168 points jbredeche | 4 comments | 15 May 25 18:06 UTC | HN request time: 0s | source
Show context
MrZander ◴[15 May 25 19:30 UTC] No.43998447[source]▶
> To accomplish that feat, the treatment is wrapped in fatty lipid molecules to protect it from degradation in the blood on its way to the liver, where the edit will be made. Inside the lipids are instructions that command the cells to produce an enzyme that edits the gene. They also carry a molecular GPS — CRISPR — which was altered to crawl along a person’s DNA until it finds the exact DNA letter that needs to be changed.

That is one of the most incredible things I have ever read.

replies(20): >>43998602 #>>43999018 #>>43999182 #>>43999228 #>>43999351 #>>43999647 #>>43999883 #>>44000363 #>>44000383 #>>44000524 #>>44000545 #>>44000725 #>>44001330 #>>44002188 #>>44002243 #>>44002289 #>>44002568 #>>44003457 #>>44008340 #>>44011060 #
poyu ◴[15 May 25 19:46 UTC] No.43998602[source]▶
Made it sound like it's a computer, is it Turing complete?
replies(9): >>43998643 #>>43998749 #>>43998847 #>>43998855 #>>43998871 #>>43998952 #>>43998991 #>>43999148 #>>44000096 #
1. fwip ◴[15 May 25 20:13 UTC] No.43998847[source]▶
Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
replies(2): >>44000195 #>>44002182 #
2. anthk ◴[15 May 25 22:58 UTC] No.44000195[source]▶
So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.
3. xarope ◴[16 May 25 05:48 UTC] No.44002182[source]▶
TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

(core war, anybody?)

replies(1): >>44012206 #
4. duskwuff ◴[17 May 25 05:16 UTC] No.44012206[source]▶
I don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/